circad | circRNAs associated with diseases

hsa_circRNA_102913/hsa_circ_0058058
Gene	ATIC	Organism	Human
Genome Locus	chr2:216177220:216190861:+	Build	hg19
Disease	Esophageal Cancer	ICD-10	Oesophagus, unspecified (C15.9)
DBLink	Link to database	PMID	27465405
Experimental Method
Sample Type	KYSE-150 Cell lines	Comparison	3 samples from human Esophageal Squamous Cancer cell lines KYSE-150 and radioresistant KYSE-150R cell lines
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGTCCACGGAGATGCAGAGC Reverse AGCGACCAGATTCAAACCAAGA	Statistics	Fold Change : Downregulated,2.69 pvalue : p<0.05
Citation
Su, H, Lin, F, Deng, X, Shen, L, Fang, Y, Fei, Z, Zhao, L, Zhang, X, Pan, H, Xie, D, Jin, X, Xie, C (2016). Profiling and bioinformatics analyses reveal differential circular RNA expression in radioresistant esophageal cancer cells. J Transl Med, 14, 1:225.